About   Help   FAQ
Rasgef1aem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Rasgef1aem1(IMPC)J
Name: RasGEF domain family, member 1A; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5903207
Gene: Rasgef1a  Location: Chr6:117988466-118068507 bp, + strand  Genetic Position: Chr6, 55.85 cM, cytoband F1
Alliance: Rasgef1aem1(IMPC)J page
IMPC: Rasgef1a gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Rasgef1a-8583J-1847M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGGCGACTAGGCTTACAGCA, CTGCTGCTCTTAGTCCCAGA, TGACAGATCTGGTCCTCCCT and TGCCTGCTCAGAGGAGCCTG, which resulted in a 836 bp deletion beginning at Chromosome 6 positive strand position 118,088,863 bp, GAGAGACACAGGCCCTGCTG, and ending after ACAGATCTGGTCCTCCCTAG at 118,089,698 bp (GRCm38/mm10). This mutation deletes exons 11-12 and 639 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 408 and early truncation 4 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 1 RNA-Seq or microarray experiment(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Rasgef1a Mutation:  18 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory