About   Help   FAQ
Asmtem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Asmtem1(IMPC)J
Name: acetylserotonin O-methyltransferase; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5903080
Gene: Asmt  Location: ChrX:169106379-169111787 bp, + strand  Genetic Position: ChrXY, Syntenic
Alliance: Asmtem1(IMPC)J page
IMPC: Asmt gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Asmt-8570J-1754F was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTGGCCCCGCCCCATCCCCA, GGAGTGACGTCATCGGGGGC, GTGAAGCCCCGCCCACGGCG and CGTGACCTTTGACCTTCAGT, which resulted in a 405 bp deletion beginning at Chromosome X positive strand position 170,674,525 bp, GCCCCCGATGACGTCACTCC, and ending after GTGTTAGCGGGGTGGGCGGG at 170,674,929 bp (GRCm38/mm10). This mutation deletes exon 3 and 272 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a single bp insertion (T) and a 4 bp deletion (CTGG) 165 bp before the 405 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 87 and early truncation 199 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Asmt Mutation:  22 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory