Alpk2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Alpk2^em1(IMPC)J
• Name: alpha-kinase 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5901883
• Gene: Alpk2 Location: Chr18:65398600-65526959 bp, - strand Genetic Position: Chr18, 38.41 cM
• Alliance: Alpk2^em1(IMPC)J page
• IMPC: Alpk2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Alpk2-8569J-1734M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGGCAAACATGAGCACACCA, AGGTAATCCATTCATACAGA, GGTCAGTTGAAGTTATAAAT and ATCCCATTGTGCTCATCAAT, which resulted in a 493 bp deletion beginning at Chromosome 18 negative strand position 65,372,964 bp, TCAATAGGCCTTCTTATTAA, and ending after CTCCCTAGACAGTATAGCAC at 65,372,472 bp (GRCm38/mm10). In addition there is a 28 bp insertion, ATTGTAAAAGGGTCAGTTGAAGTTATTA, apparently from nearby Chr:18 65,372,889-65,372,916, into the deletion site that is not predicted to alter the results of the exon deletion. This mutation deletes exon 3 and 375 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 36 and early truncation 19 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Alpk2 Mutation: 95 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)