About   Help   FAQ
Alpk2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Alpk2em1(IMPC)J
Name: alpha-kinase 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5901883
Gene: Alpk2  Location: Chr18:65398600-65526959 bp, - strand  Genetic Position: Chr18, 38.41 cM
Alliance: Alpk2em1(IMPC)J page
IMPC: Alpk2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Alpk2-8569J-1734M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGGCAAACATGAGCACACCA, AGGTAATCCATTCATACAGA, GGTCAGTTGAAGTTATAAAT and ATCCCATTGTGCTCATCAAT, which resulted in a 493 bp deletion beginning at Chromosome 18 negative strand position 65,372,964 bp, TCAATAGGCCTTCTTATTAA, and ending after CTCCCTAGACAGTATAGCAC at 65,372,472 bp (GRCm38/mm10). In addition there is a 28 bp insertion, ATTGTAAAAGGGTCAGTTGAAGTTATTA, apparently from nearby Chr:18 65,372,889-65,372,916, into the deletion site that is not predicted to alter the results of the exon deletion. This mutation deletes exon 3 and 375 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 36 and early truncation 19 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Alpk2 Mutation:  95 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory