About   Help   FAQ
Kash5em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Kash5em1(IMPC)J
Name: KASH domain containing 5; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5901859
Gene: Kash5  Location: Chr7:44833048-44854316 bp, - strand  Genetic Position: Chr7, 29.17 cM
Alliance: Kash5em1(IMPC)J page
IMPC: Kash5 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Ccdc155-8506J-0155M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTAGTCCCAAGCCAACCACA, GCATCTAAAAGGACACGGAG, CAGACACTGTTCTTAAACCG and CTCTGGCCTGGTTACAGCAG, which resulted in a 424 bp deletion beginning at Chromosome 7 negative strand position 45,196,244 bp, AACCTGCTGATGACAGACAC, and ending after CACGGAGGGGTGAAGGGGTC at 45,195,821 bp (GRCm38/mm10). In addition there is an intronic 17 bp deletion 101 bp before the 424 bp deletion, that will not alter the result of the exon deletion. This mutation deletes exon 4 and 237 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 120 and early truncation 1 amino acid later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 4 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Kash5 Mutation:  17 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory