Kash5em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Kash5em1(IMPC)J |
Name: |
KASH domain containing 5; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5901859 |
Gene: |
Kash5 Location: Chr7:44833048-44854316 bp, - strand Genetic Position: Chr7, 29.17 cM
|
Alliance: |
Kash5em1(IMPC)J page
|
IMPC: |
Kash5 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from project Ccdc155-8506J-0155M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTAGTCCCAAGCCAACCACA, GCATCTAAAAGGACACGGAG, CAGACACTGTTCTTAAACCG and CTCTGGCCTGGTTACAGCAG, which resulted in a 424 bp deletion beginning at Chromosome 7 negative strand position 45,196,244 bp, AACCTGCTGATGACAGACAC, and ending after CACGGAGGGGTGAAGGGGTC at 45,195,821 bp (GRCm38/mm10). In addition there is an intronic 17 bp deletion 101 bp before the 424 bp deletion, that will not alter the result of the exon deletion. This mutation deletes exon 4 and 237 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 120 and early truncation 1 amino acid later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|