About   Help   FAQ
Hmg20aem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Hmg20aem1(IMPC)J
Name: high mobility group 20A; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5901855
Gene: Hmg20a  Location: Chr9:56325893-56404220 bp, + strand  Genetic Position: Chr9, 30.13 cM, cytoband C
Alliance: Hmg20aem1(IMPC)J page
IMPC: Hmg20a gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Hmg20a-8517J-1759F was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGAAGTATGTAAGTTCAGCA, GAAGGTAGCATATAAAAGCC, GCCCTGCTGAACATTATAGG and ACTGCGGCTTCCAAAGCAAT, which resulted in a 788 bp deletion beginning at Chromosome 9 positive strand position 56,474,209 bp CTGGTCCATTACTAGGGTTT, and ending after GCTGTTTTGATATAGGGTCT at 56,474,996 bp (GRCm38/mm10). This mutation deletes exon 3 and 643 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 30 and early truncation 34 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Hmg20a Mutation:  34 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/23/2024
MGI 6.23
The Jackson Laboratory