Larp1b^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Larp1b^em1(IMPC)J
• Name: La ribonucleoprotein 1B; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5901853
• Gene: Larp1b Location: Chr3:40904263-40994669 bp, + strand Genetic Position: Chr3, 19.61 cM, cytoband C
• Alliance: Larp1b^em1(IMPC)J page
• IMPC: Larp1b gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Larp1b-8531J-915F was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TATAACCTCCAGATCACACG, CAGTAGTCCTCTGACACGAT, ATATTTTCTCAATATCCTAG and AATGTCATTGCCTAATGAGA, which resulted in a 528 bp deletion beginning at Chromosome 3 positive strand position 40,970,239 bp GTGATCTGGAGGTTATATGC, and ending after AAATGTCATTGCCTAATGAG at 40,970,766 bp (GRCm38/mm10). In addition there is a 9 bp insertion (ATGAAAAAA) at the deletion site that will not alter the results of the exon deletion. This mutation deletes exon 7 and 362 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 168 and early truncation 28 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Larp1b Mutation: 35 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)