About   Help   FAQ
Larp1bem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Larp1bem1(IMPC)J
Name: La ribonucleoprotein 1B; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5901853
Gene: Larp1b  Location: Chr3:40904263-40994669 bp, + strand  Genetic Position: Chr3, 19.61 cM, cytoband C
Alliance: Larp1bem1(IMPC)J page
IMPC: Larp1b gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Larp1b-8531J-915F was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TATAACCTCCAGATCACACG, CAGTAGTCCTCTGACACGAT, ATATTTTCTCAATATCCTAG and AATGTCATTGCCTAATGAGA, which resulted in a 528 bp deletion beginning at Chromosome 3 positive strand position 40,970,239 bp GTGATCTGGAGGTTATATGC, and ending after AAATGTCATTGCCTAATGAG at 40,970,766 bp (GRCm38/mm10). In addition there is a 9 bp insertion (ATGAAAAAA) at the deletion site that will not alter the results of the exon deletion. This mutation deletes exon 7 and 362 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 168 and early truncation 28 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Larp1b Mutation:  33 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/07/2025
MGI 6.24
The Jackson Laboratory