About   Help   FAQ
Nt5dc3em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Nt5dc3em1(IMPC)J
Name: 5'-nucleotidase domain containing 3; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5901849
Gene: Nt5dc3  Location: Chr10:86614869-86674253 bp, + strand  Genetic Position: Chr10, 43.11 cM
Alliance: Nt5dc3em1(IMPC)J page
IMPC: Nt5dc3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Nt5dc3-8542J-8383M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTGGGTGGCTTCTAAACAGA, TGTCATCTCCTGGGATAGAT, GGTCTGGGCATGAATGCGCA and TCTACTCTTCAGACACCAAA, which resulted in a 343 bp deletion beginning at Chromosome 10 positive strand position 86,804,714 bp, CTCTGTTTAGAAGCCACCCA, and ending after ATTCATGCCCAGACCCTGCC at 86,805,056 bp (GRCm38/mm10). This mutation deletes exon 2 and 158 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 67 and early truncation 8 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Nt5dc3 Mutation:  18 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory