About   Help   FAQ
Phkbem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Phkbem1(IMPC)J
Name: phosphorylase kinase beta; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5901846
Gene: Phkb  Location: Chr8:86567588-86788005 bp, + strand  Genetic Position: Chr8, 41.61 cM
Alliance: Phkbem1(IMPC)J page
IMPC: Phkb gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Phkb-8543J-8397M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTAATGCTCTAAGTAGTTGG, TGTGCAGTATGGATTTGCAG, GTTCTCCTGCTAACTCCACG and CTCGTCCACGTGGAGTTAGC, which resulted in a 329 bp deletion beginning at Chromosome 8 positive strand position 85,877,961 bp, ATTTGCAGTGGGCTAGAGTT, and ending after TGCTAACTCCACGTGGACGA at 85,878,289 bp (GRCm38/mm10). This mutation deletes exon 4 and 190 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 47 and early truncation 17 amino acids later. (J:188991, J:384794)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Disease models
Loading...
Expression
In Structures Affected by this Mutation: 4 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Phkb Mutation:  72 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  5 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/19/2026
MGI 6.24
The Jackson Laboratory