Aacs^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Aacs^em1(IMPC)J
• Name: acetoacetyl-CoA synthetase; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5898379
• Gene: Aacs Location: Chr5:125552937-125594469 bp, + strand Genetic Position: Chr5, 64.24 cM, cytoband F
• Alliance: Aacs^em1(IMPC)J page
• IMPC: Aacs gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Aacs-8504J-0112F was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GATGTCACGTGCCATGGACT, CTCTTCAGCCGAGCCTCAAA, TCCTCAAGCAACATTTCACT and ATTTCACTCGGAAACAATCA, which resulted in a 256 bp deletion beginning at Chromosome 5 positive strand position 125,482,732 bp, ATTTCACTCGGAAACAATCA, and ending after GGATGTCACGTGCCATGGAC at 125,482,987 bp (GRCm38/mm10). This mutation deletes exon 2 and 152 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 45 and early truncation 51 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Aacs Mutation: 33 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)