Del(7)3J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Del(7)3J
• Name: deletion Chr 7, Jackson 3
• MGI ID: MGI:5897840
• Synonyms: Hspb6^em1(IMPC)J
• Gene: Del(7)3J Location: unknown Genetic Position: Chr7, Syntenic
• IMPC: Del(7)3J gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Deletion
• Del(7)3J involves 2 genes/genome features (Hspb6, Lin37) View all
• Mutation details: This deletion was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGACAGTCTACACAAGTCCT, ACTTGGTTACCACAAAGAGG, GGATTTAGCAACTGCTACAG and CAACTGCTACAGAGGACACT, which resulted in a 1488 bp deletion beginning at Chromosome 7 positive strand position 30,554,158bp, CCTCGGCAGCAGCACTGTAA, and ending after GGATTTAGCAACTGCTACAG at 30,555,645 bp (GRCm38/mm10) that disrupts both Hspb6 and Lin37. From Hspb6 ENSMUSE00001259506 and ENSMUSE00000803270 (exons 2 and 3) are deleted along with 390 bp of flanking intronic sequence including the splice acceptor and donor, which is predicted to cause a change in amino acids sequence after residue 67 and early truncation 20 amino acids later due to read through. From Lin37 ENSMUSE00000675817 (exon 9) is deleted along with 36 bp of the flanking intron, and this exon deletion is predicted to cause an early stop after residue 208 in Lin37. In addition, there is a 2 bp (AG) deletion 84 bp before the 1488 bp deletion and a single bp insertion (T) at the deletion site. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Del(7)3J Mutation: 1 strain or line available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)