About   Help   FAQ
Kri1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Kri1em1(IMPC)J
Name: KRI1 homolog; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5897838
Gene: Kri1  Location: Chr9:21184753-21199265 bp, - strand  Genetic Position: Chr9, 7.76 cM
Alliance: Kri1em1(IMPC)J page
IMPC: Kri1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Kri1-8530J-910M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CGTCAGCTGCCAGTTCCCGA, ACAGGCCCTGAGCCACCCTC, GCAGAGAATGCAATAGGGCA and GGGCGAGTACCATATAGCCC, which resulted in a 356 bp deletion beginning at Chromosome 9 negative strand position 21,285,546 bp, GGGCTATATGGTACTCGCCC, and ending after AGTTCCCGAGGGACCCTGAG at 21,285,191 bp (GRCm38/mm10). This mutation deletes exon 4 and 229 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 92 and early truncation 25 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Kri1 Mutation:  34 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory