About   Help   FAQ
Dusp15em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Dusp15em1(IMPC)J
Name: dual specificity phosphatase-like 15; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5897441
Gene: Dusp15  Location: Chr2:152782917-152793618 bp, - strand  Genetic Position: Chr2, 75.41 cM
Alliance: Dusp15em1(IMPC)J page
IMPC: Dusp15 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Dusp15-8505J-0098M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCTGTTGGTGAGCCTTGGGA, ACCAAGGTTGACCTTCGTGT, ACCAATAGAGAAGAGCTGCG and GTCTCAGGTAGAGATCAGGG, which resulted in a 553 bp deletion in total, beginning at Chromosome 2 negative strand position 152,950,921 bp, TGATCTCTACCTGAGACTTC, deleting 385 bp then retaining 4 endogenous bp (ACTT) in the intron, then removing 168 bp, and ending after AGGCTAAAGGCCCACACGAA at 152,950,365 bp (GRCm38/mm10). This mutation deletes exon 2 and 519 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 7 and early truncation 79 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Dusp15 Mutation:  14 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/23/2024
MGI 6.23
The Jackson Laboratory