Dusp15em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Dusp15em1(IMPC)J |
| Name: |
dual specificity phosphatase-like 15; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5897441 |
| Gene: |
Dusp15 Location: Chr2:152782917-152793618 bp, - strand Genetic Position: Chr2, 75.41 cM
|
| Alliance: |
Dusp15em1(IMPC)J page
|
| IMPC: |
Dusp15 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project Dusp15-8505J-0098M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCTGTTGGTGAGCCTTGGGA, ACCAAGGTTGACCTTCGTGT, ACCAATAGAGAAGAGCTGCG and GTCTCAGGTAGAGATCAGGG, which resulted in a 553 bp deletion in total, beginning at Chromosome 2 negative strand position 152,950,921 bp, TGATCTCTACCTGAGACTTC, deleting 385 bp then retaining 4 endogenous bp (ACTT) in the intron, then removing 168 bp, and ending after AGGCTAAAGGCCCACACGAA at 152,950,365 bp (GRCm38/mm10). This mutation deletes exon 2 and 519 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 7 and early truncation 79 amino acids later.
(J:188991, J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
4 reference(s) |
|