Ubiad1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Ubiad1em1(IMPC)J |
Name: |
UbiA prenyltransferase domain containing 1; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5896808 |
Gene: |
Ubiad1 Location: Chr4:148518952-148529217 bp, - strand Genetic Position: Chr4, 78.76 cM, cytoband E1
|
Alliance: |
Ubiad1em1(IMPC)J page
|
IMPC: |
Ubiad1 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from project Ubiad1-8387J-M4740 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACTTAGGGAGAAGTGCCATA, ACTGTTCCCAAATTCATCAC, AGAATACCATGTCTGAAGAG and TCCGGGTACACAGAGATGAG, which resulted in a 2599 bp deletion beginning at Chromosome 4 negative strand position 148,436,873 bp, TCTCTGTGTACCCGGAGCTC, and ending after AGGACTTAGGGAGAAGTGCC at 148,434,275 bp (GRCm38/mm10). This mutation deletes exon 2 and 451 bp of flanking intronic sequence including the splice acceptor and is predicted to cause early truncation after amino acid residue 174.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
3 reference(s) |
|