About   Help   FAQ
Gimap3em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Gimap3em1(IMPC)J
Name: GTPase, IMAP family member 3; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5883410
Synonyms: Gimap3em1J
Gene: Gimap3  Location: Chr6:48741398-48747785 bp, - strand  Genetic Position: Chr6, 23.72 cM
Alliance: Gimap3em1(IMPC)J page
IMPC: Gimap3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Gimap3-8295J-F2029 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTTCCTGCCCCCAAAAAGAA, TAAGCCAGCAACAGGCTAGC, GCAATGGCCTATCATCTCAG and GTAATGTTGGTAAAGCAGAG, which resulted in a 930 bp deletion beginning at Chromosome 6 negative strand position 48,766,201 bp ATCATCTCAGAGGAAGGTCC, and ending after AAGCCTATAGGTGCTACCTG at 48,765,272 bp (GRCm38/mm10). This mutation deletes 695 bp of exon 2 and 235 bp of intron 1 sequence including the splice acceptor. In addition there is an 8 bp deletion (GCTAGCAG) 304 bp after the 930 bp deletion that will not alter the results of the mutation. This mutation is predicted to cause a change of amino acid sequence after residue 10 and early truncation 14 amino acids later, possibly due to read through of intron 1. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Gimap3 Mutation:  26 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory