Gimap3^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gimap3^em1(IMPC)J
• Name: GTPase, IMAP family member 3; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5883410
• Synonyms: Gimap3^em1J
• Gene: Gimap3 Location: Chr6:48741398-48747785 bp, - strand Genetic Position: Chr6, 23.72 cM
• Alliance: Gimap3^em1(IMPC)J page
• IMPC: Gimap3 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Gimap3-8295J-F2029 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTTCCTGCCCCCAAAAAGAA, TAAGCCAGCAACAGGCTAGC, GCAATGGCCTATCATCTCAG and GTAATGTTGGTAAAGCAGAG, which resulted in a 930 bp deletion beginning at Chromosome 6 negative strand position 48,766,201 bp ATCATCTCAGAGGAAGGTCC, and ending after AAGCCTATAGGTGCTACCTG at 48,765,272 bp (GRCm38/mm10). This mutation deletes 695 bp of exon 2 and 235 bp of intron 1 sequence including the splice acceptor. In addition there is an 8 bp deletion (GCTAGCAG) 304 bp after the 930 bp deletion that will not alter the results of the mutation. This mutation is predicted to cause a change of amino acid sequence after residue 10 and early truncation 14 amino acids later, possibly due to read through of intron 1. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Gimap3 Mutation: 27 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)