B3galnt2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: B3galnt2^em1(IMPC)J
• Name: UDP-GalNAc:betaGlcNAc beta 1,3-galactosaminyltransferase, polypeptide 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5883341
• Synonyms: B3galnt2^em1J
• Gene: B3galnt2 Location: Chr13:14129059-14173688 bp, + strand Genetic Position: Chr13, 5.29 cM
• Alliance: B3galnt2^em1(IMPC)J page
• IMPC: B3galnt2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project B3galnt2-7842J-F8897 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCTGGCCTAACAAAAGGAGA, CTCAGTAGTTAGCAGCCCTT, TAAATTCGTTGTCAAGTAAA and CAGACTTATTAGACTTATTA, which resulted in a two-part deletion of 379 bp in total. This deletion begins at Chromosome 13 positive strand position 13,970,629 bp deletes 29 bp CCCTTGGGTTTCATGCCCTCTCCTTTTGT, then retains 3 endogenous bp (TAG) in the intron, then removes 350 bp and ends after TGACAGACTTATTAGACTTA at 13,971,010 bp (GRCm38/mm10). This mutation deletes exon 3 and 278 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 88 and early truncation 5 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any B3galnt2 Mutation: 67 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)