About   Help   FAQ
B3galnt2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: B3galnt2em1(IMPC)J
Name: UDP-GalNAc:betaGlcNAc beta 1,3-galactosaminyltransferase, polypeptide 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5883341
Synonyms: B3galnt2em1J
Gene: B3galnt2  Location: Chr13:14129059-14173688 bp, + strand  Genetic Position: Chr13, 5.29 cM
Alliance: B3galnt2em1(IMPC)J page
IMPC: B3galnt2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project B3galnt2-7842J-F8897 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCTGGCCTAACAAAAGGAGA, CTCAGTAGTTAGCAGCCCTT, TAAATTCGTTGTCAAGTAAA and CAGACTTATTAGACTTATTA, which resulted in a two-part deletion of 379 bp in total. This deletion begins at Chromosome 13 positive strand position 13,970,629 bp deletes 29 bp CCCTTGGGTTTCATGCCCTCTCCTTTTGT, then retains 3 endogenous bp (TAG) in the intron, then removes 350 bp and ends after TGACAGACTTATTAGACTTA at 13,971,010 bp (GRCm38/mm10). This mutation deletes exon 3 and 278 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 88 and early truncation 5 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any B3galnt2 Mutation:  67 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory