Itgb3bp^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Itgb3bp^em1(IMPC)J
• Name: integrin beta 3 binding protein (beta3-endonexin); endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5883322
• Synonyms: Itgb3bp^em1J
• Gene: Itgb3bp Location: Chr4:99655643-99717403 bp, - strand Genetic Position: Chr4, 45.71 cM, cytoband C6
• Alliance: Itgb3bp^em1(IMPC)J page
• IMPC: Itgb3bp gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Itgb3bp-8308J-F0692 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATATAGCTCTTGTTGCAGCT, TTATAATTGATAGTAGCTGA, AAGTAGCTACCTTATTTGAG and GAGTTTTCATGAGTTACTTA, which resulted in a 2 part deletion of 558 bp in total. This deletion begins at Chromosome 4 negative strand position 99,802,399 bp TTTGAGAGGAATACTGGTCA, removes 222 bp then retains 4 endogenous exonic bases (CTAC) and ends after TATGGCCTGACTGCCTTCAG at 99,801,838 bp (GRCm38/mm10). This mutation deletes 132 bp in exon 3 and 426 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 17 and early truncation 7 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Itgb3bp Mutation: 16 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)