Agbl1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Agbl1^em1(IMPC)J
• Name: ATP/GTP binding protein-like 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5882076
• Synonyms: Agbl1^em1J
• Gene: Agbl1 Location: Chr7:75879635-76774446 bp, + strand Genetic Position: Chr7, 43.87 cM
• Alliance: Agbl1^em1(IMPC)J page
• IMPC: Agbl1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Agbl1-8255J-F6210 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGTTCCATGATGAATCTGGA, ACAGTGCTCTTGCTTAATAA, TCCAGACATCACTATCGTTG and ATGAATATTATTGCAACCAA, which resulted in a two part deletion of 266 bp in total. This deletion begins at Chromosome 7 positive strand position 76,414,540 bp, deletes 17 bp, CTTAATAATGGGTCCCT, then retains 4 endogenous bp (CATT) of the intron, then removes 249 bp ending after TGAACTTACCCCAACGATAG at 76,414,809 bp (GRCm38/mm10). This mutation deletes exon 9 and 201 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 300 and early truncation 1 amino acid later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

5 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Agbl1 Mutation: 63 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)