Prkag2em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Prkag2em1(IMPC)J |
| Name: |
protein kinase, AMP-activated, gamma 2 non-catalytic subunit; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5829423 |
| Synonyms: |
Prkag2em1J |
| Gene: |
Prkag2 Location: Chr5:25067742-25305640 bp, - strand Genetic Position: Chr5, 11.93 cM
|
| Alliance: |
Prkag2em1(IMPC)J page
|
| IMPC: |
Prkag2 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences CTACCTGCTCTAGTCCTCCG, GCATTCCCTTGTCACCTCTG, GCTGTCTAACAGAGCCTCAA, and TTGATGCTATGGTTTCAGGT that targeted exon(s) ENSMUSE00000259717.4 ENSMUSE00001899029.1. This resulted in deletion(s) of 2 bp (location: Chr5:25227413-25227414; GRCm39), 686 bp (location: Chr5:25226604-25227289; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
4 reference(s) |
|