Pxdnem1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Pxdnem1(IMPC)J |
Name: |
peroxidasin; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5829376 |
Synonyms: |
Pxdnem1J |
Gene: |
Pxdn Location: Chr12:29987607-30067657 bp, + strand Genetic Position: Chr12, 13.0 cM
|
Alliance: |
Pxdnem1(IMPC)J page
|
IMPC: |
Pxdn gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from project Pxdn-8144J-M7082 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAGCCATAACAAGATCAAGG, GGAAGTTGATCTATCCAGGA, ATCCCCAGTTCACGTTGCAG and GTCACACTGGTCCTTCAGTA, which resulted in a 688 bp deletion beginning at Chromosome 12 positive strand position 29,984,151 bp CTTGATCTTGTTATGGCTGT, and ending after CACGTGAGCCTCACATTTTT at 29,984,838 bp (GRCm38/mm10). This mutation deletes exon 7 and 518 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 184 and early truncation 25 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
3 reference(s) |
|