Pxdn^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pxdn^em1(IMPC)J
• Name: peroxidasin; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5829376
• Synonyms: Pxdn^em1J
• Gene: Pxdn Location: Chr12:29987607-30067657 bp, + strand Genetic Position: Chr12, 13.0 cM
• Alliance: Pxdn^em1(IMPC)J page
• IMPC: Pxdn gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Pxdn-8144J-M7082 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAGCCATAACAAGATCAAGG, GGAAGTTGATCTATCCAGGA, ATCCCCAGTTCACGTTGCAG and GTCACACTGGTCCTTCAGTA, which resulted in a 688 bp deletion beginning at Chromosome 12 positive strand position 29,984,151 bp CTTGATCTTGTTATGGCTGT, and ending after CACGTGAGCCTCACATTTTT at 29,984,838 bp (GRCm38/mm10). This mutation deletes exon 7 and 518 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 184 and early truncation 25 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Pxdn Mutation: 70 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)