About   Help   FAQ
Pxdnem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Pxdnem1(IMPC)J
Name: peroxidasin; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5829376
Synonyms: Pxdnem1J
Gene: Pxdn  Location: Chr12:29987607-30067657 bp, + strand  Genetic Position: Chr12, 13.0 cM
Alliance: Pxdnem1(IMPC)J page
IMPC: Pxdn gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Pxdn-8144J-M7082 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAGCCATAACAAGATCAAGG, GGAAGTTGATCTATCCAGGA, ATCCCCAGTTCACGTTGCAG and GTCACACTGGTCCTTCAGTA, which resulted in a 688 bp deletion beginning at Chromosome 12 positive strand position 29,984,151 bp CTTGATCTTGTTATGGCTGT, and ending after CACGTGAGCCTCACATTTTT at 29,984,838 bp (GRCm38/mm10). This mutation deletes exon 7 and 518 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 184 and early truncation 25 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Pxdn Mutation:  67 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/23/2024
MGI 6.23
The Jackson Laboratory