About   Help   FAQ
Gsto1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Gsto1em1(IMPC)J
Name: glutathione S-transferase omega 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5827741
Synonyms: Gsto1em1J
Gene: Gsto1  Location: Chr19:47843412-47853229 bp, + strand  Genetic Position: Chr19, 40.41 cM
Alliance: Gsto1em1(IMPC)J page
IMPC: Gsto1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Gsto1-8314J-F9698 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCAGGAGGGCATCTGACCCA, AATCGGGCCACACTAATTCA, ACTCAGCGCTGCCTTTGTGA and AGCAGGAACAGAGCGTGCCA, which resulted in a deletion of 443 bp in total. This deletion begins at Chromosome 19 positive strand position 47,857,710 bp deleting 21 bp, CCCAGGGTCTTAACCTTCGGG, then retains 4 endogenous bp (TGCA) in the intron, then removes 422 bp ending after ACTCAGCGCTGCCTTTGTGA at 47,858,156 bp (GRCm38/mm10). This mutation deletes exon 3 and 223 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 48 and early truncation 3 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Gsto1 Mutation:  19 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory