Kynuem1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Kynuem1(IMPC)J |
| Name: |
kynureninase; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5827722 |
| Synonyms: |
Kynuem1J |
| Gene: |
Kynu Location: Chr2:43445341-43572734 bp, + strand Genetic Position: Chr2, 25.64 cM, cytoband C1
|
| Alliance: |
Kynuem1(IMPC)J page
|
| IMPC: |
Kynu gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project Kynu-8351J-M627 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGCATAACTTAAACCCACAG, CTTCCAATCACAAATAGCCA, CTTCTTTGCTGGACATTAAA and TGGAGTTACACCTTTTAACT, which resulted in a deletion of 340 bp in total. This deletion begins at Chromosome 2 positive strand position 43,581,141 bp, CCTCTGTGGGTTTAAGTTA, removes 19 bp, then retains 3 endogenous bases (TGC) in the intron, and then removes 321 bp, ending after GATGTAAGTACCAAGTTAAA at 43,581,483 bp (GRCm38/mm10). This mutation deletes exon 3 and 219 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 57 and early truncation 7 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
4 reference(s) |
|