About   Help   FAQ
Tcn2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Tcn2em1(IMPC)J
Name: transcobalamin 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5827580
Synonyms: Tcn2em1J
Gene: Tcn2  Location: Chr11:3867192-3882159 bp, - strand  Genetic Position: Chr11, 2.76 cM
Alliance: Tcn2em1(IMPC)J page
IMPC: Tcn2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Tcn2-8386J-M4720 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGATCCAAGTTATAAGAGAT, TATAACTTGGATCAAGTCAC, ATAGAGGGCATTTCTCCTGG and ATAGTTGCTTGCTAGTGGCA, which resulted in a 646 bp deletion beginning at Chromosome 11 negative strand position 3,927,730 bp GCATTTCTCCTGGCGGGCTG, and ending after CAGGCTGGATTCTAATTGGG at 3,927,085 bp (GRCm38/mm10). This mutation deletes exon 3 and 453 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 21 and early truncation 41 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Tcn2 Mutation:  22 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory