Fbxo10^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Fbxo10^em1(IMPC)J
• Name: F-box protein 10; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5827555
• Synonyms: Fbxo10^em1J
• Gene: Fbxo10 Location: Chr4:45034248-45084555 bp, - strand Genetic Position: Chr4, 23.68 cM
• Alliance: Fbxo10^em1(IMPC)J page
• IMPC: Fbxo10 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Fbxo10- 8390J-M4753 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTAATCTCCCGAGGAGCAGG, AGTGCCAGATAGTCTGGGCA, GTACCAAGACGGACACAGCC and GCTGTGTGCTCAGGAATGGC, which resulted in a 512 bp deletion beginning at Chromosome 4 positive strand position 45,048,176 bp, GGAGGCACATGGTTGCCTTT, and ending after AGGACAAAACACCACCAGCC at 45,048,687 bp (GRCm38/mm10). This mutation deletes exon 5 and 375 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 519 and early truncation 28 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Fbxo10 Mutation: 50 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)