Rnf24em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Rnf24em1(IMPC)J |
Name: |
ring finger protein 24; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5825334 |
Synonyms: |
Rnf24em1J |
Gene: |
Rnf24 Location: Chr2:131139984-131194766 bp, - strand Genetic Position: Chr2, 63.32 cM
|
Alliance: |
Rnf24em1(IMPC)J page
|
IMPC: |
Rnf24 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from project Rnf24-8318J-M9794 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TATGCACTCCATTAAGTCAG, TCTGTGGTATAAACTGACAA, ATTTCTCTAGAACTTAAGAG and GTACTATCCCATGGTTCAGT, which resulted in a 344 bp deletion beginning at Chromosome 2 negative strand position 131,308,577 bp, TGGTTCAGTGGGAACTCTCT, and ending after CAGTATTTGTCGAAGAAAAA at 131,308,234 bp (GRCm38/mm10). This mutation deletes exon 3 and 301 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 14 bp deletion (GAACTTAAGAGTGGG) 10 bp before the 344 bp deletion and an 8 bp deletion (TTTGATGT) 57 bp before the 344 bp deletion, neither of which are expected to alter the effect of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 49 and early truncation 1 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|