About   Help   FAQ
Bckdhbem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Bckdhbem1(IMPC)J
Name: branched chain ketoacid dehydrogenase E1, beta polypeptide; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5825325
Synonyms: Bckdhb-, Bckdhbem1J
Gene: Bckdhb  Location: Chr9:83807198-84006293 bp, + strand  Genetic Position: Chr9, 45.67 cM
Alliance: Bckdhbem1(IMPC)J page
IMPC: Bckdhb gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Bckhb-8188J-M1369 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCAAATCCCAGGTATCTCAA, CAATACGCATCTGAAAATGA, GCAGTTCGCATTTTGTAGAG and TGAGGGTCTCCAGCTTTCCG, which resulted in a 528 bp deletion beginning at Chromosome 9 positive strand position 83,988,526 bp, TTGAGATACCTGGGATTTGC, and ending after GCAGTTCGCATTTTGTAGAG at 83,989,053 bp (GRCm38/mm10). This mutation deletes exon 4 and 394 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 112 and early truncation 13 amino acids later. Western blot analysis confirmed the absence of the protein in the liver, heart and brain of homozygous mutant neonates. (J:188991, J:344897)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Disease models
Loading...
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Bckdhb Mutation:  21 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
08/05/2025
MGI 6.24
The Jackson Laboratory