Xkr4^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Xkr4^em1(IMPC)J
• Name: X-linked Kx blood group related 4; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5825311
• Synonyms: Xkr4^em1J
• Gene: Xkr4 Location: Chr1:3276124-3741721 bp, - strand Genetic Position: Chr1, 1.6 cM
• Alliance: Xkr4^em1(IMPC)J page
• IMPC: Xkr4 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Xkr4-8176J-F8924 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTCCCAATTCAGAAACCAAA, CCTCCAGCTGTCACTTTAAC, ACAGTCTTACTAGCTCAGTT and GTACGAAAGGAAAATGACTT, which resulted in a 278 bp deletion beginning at Chromosome 1 negative strand position 3,421,962 bp, CTTTGGAGTTTGAATTTCAA, and ending after AAGGTAAGGATTTGCCATTT at 3,421,685 bp (GRCm38/mm10). This mutation deletes exon 2 and 78 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 6 bp deletion (TTTAAC) in the intron 95 bp before the deletion that will not alter the effect of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 266 and early truncation 26 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Xkr4 Mutation: 39 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)