Arl2bp^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Arl2bp^em1(IMPC)J
• Name: ADP-ribosylation factor-like 2 binding protein; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5825297
• Synonyms: Arl2bp^em1J
• Gene: Arl2bp Location: Chr8:95393228-95401053 bp, + strand Genetic Position: Chr8, 46.65 cM, cytoband C5
• Alliance: Arl2bp^em1(IMPC)J page
• IMPC: Arl2bp gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Arl2bp-8260J-M6258 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGATTGGTGAAACTGAGTGA, AAAACACTCGTGACGAAAAC, AATTGACCATAGGAACTAGA and TTACATATGTGATGGATCGT, which resulted in a 394 bp deletion beginning at Chromosome 8 positive strand position 94,667,392 bp, GTGAAACTGAGTGATGGGAG, and ending after TTTACATATGTGATGGATC at 94,667,785 bp (GRCm38/mm10). This mutation deletes exon 2 and 332 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 12 and early truncation 1 amino acid later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Arl2bp Mutation: 10 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)