About   Help   FAQ
Arl2bpem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Arl2bpem1(IMPC)J
Name: ADP-ribosylation factor-like 2 binding protein; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5825297
Synonyms: Arl2bpem1J
Gene: Arl2bp  Location: Chr8:95393228-95401053 bp, + strand  Genetic Position: Chr8, 46.65 cM, cytoband C5
Alliance: Arl2bpem1(IMPC)J page
IMPC: Arl2bp gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Arl2bp-8260J-M6258 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGATTGGTGAAACTGAGTGA, AAAACACTCGTGACGAAAAC, AATTGACCATAGGAACTAGA and TTACATATGTGATGGATCGT, which resulted in a 394 bp deletion beginning at Chromosome 8 positive strand position 94,667,392 bp, GTGAAACTGAGTGATGGGAG, and ending after TTTACATATGTGATGGATC at 94,667,785 bp (GRCm38/mm10). This mutation deletes exon 2 and 332 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 12 and early truncation 1 amino acid later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Arl2bp Mutation:  9 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/23/2024
MGI 6.23
The Jackson Laboratory