Mmaa^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mmaa^em1(IMPC)J
• Name: methylmalonic aciduria (cobalamin deficiency) type A; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5825155
• Synonyms: Mmaa^em1J
• Gene: Mmaa Location: Chr8:79990227-80021566 bp, - strand Genetic Position: Chr8, 37.51 cM
• Alliance: Mmaa^em1(IMPC)J page
• IMPC: Mmaa gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele from project Mmaa-8355J-F0649 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCTCATGGCCTCTAGCCAAT, ATGTACAGAGAAACAGCCTG, GGGTGCTGAGTTATAGCAAC and TTTACTTTTTTCCAATTTAC, which resulted in a 345 bp deletion beginning at Chromosome 8 negative strand position 79,271,097 bp, AACAGGTCATAAATCTATGA, and ending after TAGAGGCCATGAGGCCACAG at 79,270,753 bp (GRCm38/mm10). This mutation deletes exon 5 and 259 bp of flanking intronic sequence including the splice acceptor and donor. At the site of this deletion there is a 22 bp insertion (TGTGGCCTCATGGCCTCTAGCC) that derived from nearby intronic sequence, which is inverted relative to its normal orientation. This allele is predicted to cause a change of amino acid sequence after residue 242 and early truncation 6 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

5 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Mmaa Mutation: 19 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)