About   Help   FAQ
Mmaaem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Mmaaem1(IMPC)J
Name: methylmalonic aciduria (cobalamin deficiency) type A; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5825155
Synonyms: Mmaaem1J
Gene: Mmaa  Location: Chr8:79990227-80021566 bp, - strand  Genetic Position: Chr8, 37.51 cM
Alliance: Mmaaem1(IMPC)J page
IMPC: Mmaa gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele from project Mmaa-8355J-F0649 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCTCATGGCCTCTAGCCAAT, ATGTACAGAGAAACAGCCTG, GGGTGCTGAGTTATAGCAAC and TTTACTTTTTTCCAATTTAC, which resulted in a 345 bp deletion beginning at Chromosome 8 negative strand position 79,271,097 bp, AACAGGTCATAAATCTATGA, and ending after TAGAGGCCATGAGGCCACAG at 79,270,753 bp (GRCm38/mm10). This mutation deletes exon 5 and 259 bp of flanking intronic sequence including the splice acceptor and donor. At the site of this deletion there is a 22 bp insertion (TGTGGCCTCATGGCCTCTAGCC) that derived from nearby intronic sequence, which is inverted relative to its normal orientation. This allele is predicted to cause a change of amino acid sequence after residue 242 and early truncation 6 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 5 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Mmaa Mutation:  19 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
08/05/2025
MGI 6.24
The Jackson Laboratory