Mmaaem1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Mmaaem1(IMPC)J |
Name: |
methylmalonic aciduria (cobalamin deficiency) type A; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5825155 |
Synonyms: |
Mmaaem1J |
Gene: |
Mmaa Location: Chr8:79990227-80021566 bp, - strand Genetic Position: Chr8, 37.51 cM
|
Alliance: |
Mmaaem1(IMPC)J page
|
IMPC: |
Mmaa gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutations: |
|
Insertion, Intragenic deletion
|
|
|
Mutation details: This allele from project Mmaa-8355J-F0649 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCTCATGGCCTCTAGCCAAT, ATGTACAGAGAAACAGCCTG, GGGTGCTGAGTTATAGCAAC and TTTACTTTTTTCCAATTTAC, which resulted in a 345 bp deletion beginning at Chromosome 8 negative strand position 79,271,097 bp, AACAGGTCATAAATCTATGA, and ending after TAGAGGCCATGAGGCCACAG at 79,270,753 bp (GRCm38/mm10). This mutation deletes exon 5 and 259 bp of flanking intronic sequence including the splice acceptor and donor. At the site of this deletion there is a 22 bp insertion (TGTGGCCTCATGGCCTCTAGCC) that derived from nearby intronic sequence, which is inverted relative to its normal orientation. This allele is predicted to cause a change of amino acid sequence after residue 242 and early truncation 6 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|