Kctd1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Kctd1em1(IMPC)J |
| Name: |
potassium channel tetramerisation domain containing 1; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5825137 |
| Synonyms: |
Kctd1em1J |
| Gene: |
Kctd1 Location: Chr18:15101742-15284503 bp, - strand Genetic Position: Chr18, 8.28 cM
|
| Alliance: |
Kctd1em1(IMPC)J page
|
| IMPC: |
Kctd1 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project Kctd1-8309J-F0739 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGACCTACAGAAGCTGCTCA, CTCCATGTCCCCGCTTGTGG, CACAGTATACAAATAACAAG and TTACTGCAATTGATCCCCAT, which resulted in a 571 bp deletion beginning at Chromosome 18 negative strand position 15,008,135 bp, TTGTTATTTGTATACTGTGA, and ending after GCCATGGATGCCTGGCCTCC at 15,007,565 bp (GRCm38/mm10). This mutation deletes exon 2 and 392 bp of flanking intronic sequence including the splice acceptor and donor. There is a small 6 bp insertion (CCTCCA) at the deletion site that will not alter the results of the mutation. This mutation is predicted to cause a change of amino acid sequence after residue 3 and early truncation 5 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|