About   Help   FAQ
Kctd1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Kctd1em1(IMPC)J
Name: potassium channel tetramerisation domain containing 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5825137
Synonyms: Kctd1em1J
Gene: Kctd1  Location: Chr18:15101742-15284503 bp, - strand  Genetic Position: Chr18, 8.28 cM
Alliance: Kctd1em1(IMPC)J page
IMPC: Kctd1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Kctd1-8309J-F0739 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGACCTACAGAAGCTGCTCA, CTCCATGTCCCCGCTTGTGG, CACAGTATACAAATAACAAG and TTACTGCAATTGATCCCCAT, which resulted in a 571 bp deletion beginning at Chromosome 18 negative strand position 15,008,135 bp, TTGTTATTTGTATACTGTGA, and ending after GCCATGGATGCCTGGCCTCC at 15,007,565 bp (GRCm38/mm10). This mutation deletes exon 2 and 392 bp of flanking intronic sequence including the splice acceptor and donor. There is a small 6 bp insertion (CCTCCA) at the deletion site that will not alter the results of the mutation. This mutation is predicted to cause a change of amino acid sequence after residue 3 and early truncation 5 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 6 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Kctd1 Mutation:  39 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory