About   Help   FAQ
Alg8em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Alg8em1(IMPC)J
Name: ALG8 alpha-1,3-glucosyltransferase; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5825112
Synonyms: Alg8em1J
Gene: Alg8  Location: Chr7:97020813-97041392 bp, + strand  Genetic Position: Chr7, 53.48 cM
Alliance: Alg8em1(IMPC)J page
IMPC: Alg8 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Alg8-8256J-M6218 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGGGTCTCAGAGATATCCAA, TCTCAGGCAACCGCACGAAA, GCAGGCAGTTGCTCTACATG and CAGTTAACAGAGATCCACTT, which resulted in a 571 bp deletion beginning at Chromosome 7 negative strand position 97,373,999 bp CAGGCAGTTGCTCTACATGG, and ending after GTTCTCAGGCAACCGCACGA at 97,373,429 bp (GRCm38/mm10). This mutation deletes exon 2 and 492 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a single bp insertion 19 bp after the deletion that will not affect the results of the deletion. This mutation is predicted to cause a change of amino acid sequence and early truncation after residue 31. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 4 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Alg8 Mutation:  30 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory