Alg8em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Alg8em1(IMPC)J |
| Name: |
ALG8 alpha-1,3-glucosyltransferase; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5825112 |
| Synonyms: |
Alg8em1J |
| Gene: |
Alg8 Location: Chr7:97020813-97041392 bp, + strand Genetic Position: Chr7, 53.48 cM
|
| Alliance: |
Alg8em1(IMPC)J page
|
| IMPC: |
Alg8 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project Alg8-8256J-M6218 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGGGTCTCAGAGATATCCAA, TCTCAGGCAACCGCACGAAA, GCAGGCAGTTGCTCTACATG and CAGTTAACAGAGATCCACTT, which resulted in a 571 bp deletion beginning at Chromosome 7 negative strand position 97,373,999 bp CAGGCAGTTGCTCTACATGG, and ending after GTTCTCAGGCAACCGCACGA at 97,373,429 bp (GRCm38/mm10). This mutation deletes exon 2 and 492 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a single bp insertion 19 bp after the deletion that will not affect the results of the deletion. This mutation is predicted to cause a change of amino acid sequence and early truncation after residue 31.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|