Mgme1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mgme1^em1(IMPC)J
• Name: mitochondrial genome maintenance exonuclease 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5825054
• Synonyms: Mgme1^em1J
• Gene: Mgme1 Location: Chr2:144112824-144123147 bp, + strand Genetic Position: Chr2, 70.98 cM, cytoband H1
• Alliance: Mgme1^em1(IMPC)J page
• IMPC: Mgme1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Mgme1-8310J-M0767 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGGTGAAATTTTGTATCTAA, AGGGTGAAATTTTGTATCTA, GTGCCTCCTTCAGTCACTGT and GGTGGGCCAGGATTGTCTAT, which resulted in a 426 bp deletion beginning at Chromosome 2 positive strand position 144,276,173bp CTAAGGGTTTTCCATTTAAA, and ending after AATGGGTGGGCCAGGATTGT at 144,276,598 bp (GRCm38/mm10). This mutation deletes exon 3 and 209 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 168 and early truncation 5 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Mgme1 Mutation: 63 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)