About   Help   FAQ
Mgme1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Mgme1em1(IMPC)J
Name: mitochondrial genome maintenance exonuclease 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5825054
Synonyms: Mgme1em1J
Gene: Mgme1  Location: Chr2:144112824-144123147 bp, + strand  Genetic Position: Chr2, 70.98 cM, cytoband H1
Alliance: Mgme1em1(IMPC)J page
IMPC: Mgme1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Mgme1-8310J-M0767 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGGTGAAATTTTGTATCTAA, AGGGTGAAATTTTGTATCTA, GTGCCTCCTTCAGTCACTGT and GGTGGGCCAGGATTGTCTAT, which resulted in a 426 bp deletion beginning at Chromosome 2 positive strand position 144,276,173bp CTAAGGGTTTTCCATTTAAA, and ending after AATGGGTGGGCCAGGATTGT at 144,276,598 bp (GRCm38/mm10). This mutation deletes exon 3 and 209 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 168 and early truncation 5 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Mgme1 Mutation:  64 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory