Cltc^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cltc^em1(IMPC)J
• Name: clathrin heavy chain; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5823473
• Synonyms: Cltc^em1J
• Gene: Cltc Location: Chr11:86585177-86648391 bp, - strand Genetic Position: Chr11, 51.82 cM
• Alliance: Cltc^em1(IMPC)J page
• IMPC: Cltc gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Cltc-8204J-M4288 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTAAAAGCATTTCTGTATAG, TTTATATCTGACATGATAAA, AGTGTAACTTACAACTACAG and TTGTCACTATTGGTTTGGCA, which resulted in a 632 bp deletion beginning at Chromosome 11 negative strand position 86,737,459 bp TGTAGTTGTAAGTTACACTA and ending after CATTTTATATCTGACATGAT at 86,736,824 bp (GRCm38/mm10). This mutation deletes exon 2 and 424 bp of flanking intronic sequence including the splice acceptor and donor, however it retains 4 bp of the exon (AGAG), which will not alter the results of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 15 and early truncation 10 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Cltc Mutation: 93 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)