About   Help   FAQ
Cltcem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Cltcem1(IMPC)J
Name: clathrin heavy chain; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5823473
Synonyms: Cltcem1J
Gene: Cltc  Location: Chr11:86585177-86648391 bp, - strand  Genetic Position: Chr11, 51.82 cM
Alliance: Cltcem1(IMPC)J page
IMPC: Cltc gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Cltc-8204J-M4288 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTAAAAGCATTTCTGTATAG, TTTATATCTGACATGATAAA, AGTGTAACTTACAACTACAG and TTGTCACTATTGGTTTGGCA, which resulted in a 632 bp deletion beginning at Chromosome 11 negative strand position 86,737,459 bp TGTAGTTGTAAGTTACACTA and ending after CATTTTATATCTGACATGAT at 86,736,824 bp (GRCm38/mm10). This mutation deletes exon 2 and 424 bp of flanking intronic sequence including the splice acceptor and donor, however it retains 4 bp of the exon (AGAG), which will not alter the results of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 15 and early truncation 10 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Cltc Mutation:  93 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory