About   Help   FAQ
Tbc1d8em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Tbc1d8em1(IMPC)J
Name: TBC1 domain family, member 8; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5823470
Synonyms: Tbc1d8em1J
Gene: Tbc1d8  Location: Chr1:39410573-39517836 bp, - strand  Genetic Position: Chr1, 18.3 cM, cytoband B
Alliance: Tbc1d8em1(IMPC)J page
IMPC: Tbc1d8 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Tbc1d8-8160J-M2435 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AAGCGGTGCTAAGTACCCCT, ACACTTTTGCTTAATTACAT, CCTTCAGTCTAACTGTTGTC and GTAAGAACCCAACCTTGTTT, which resulted in a 449 bp deletion beginning at Chromosome 1 negative strand position 39,405,659 bp, AACAAGGTTGGGTTCTTACA, and ending after GGTACTTAGCACCGCTTCCG at 39,405,211 bp (GRCm38/mm10). This mutation deletes exon 4 and 220 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 2 bp deletion (AC) 80 bp before the 449 bp deletion that will not effect the results of this deletion. This mutation is predicted to cause a change of amino acid sequence after residue 119 and early truncation 3 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 1 RNA-Seq or microarray experiment(s)
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Tbc1d8 Mutation:  54 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory