Eef1b2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Eef1b2^em1(IMPC)J
• Name: eukaryotic translation elongation factor 1 beta 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5823412
• Synonyms: Eef1b2^em1J
• Gene: Eef1b2 Location: Chr1:63215990-63219645 bp, + strand Genetic Position: Chr1, 32.31 cM, cytoband C2
• Alliance: Eef1b2^em1(IMPC)J page
• IMPC: Eef1b2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Eef1b2-8293J-M9257 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTGTGTGTTTTGCCTAGAAA, TTAACCTTTAGCACAATCCC, GCCACGCCAGGATCCATCCA and CAAGCATATTGAGAAGCCTG, which resulted in a 329 bp deletion beginning at Chromosome 1 positive strand position 63,178,315 bp, CTGGGATTGTGCTAAAGGTT, and ending after CTCCCTGGATGGATCCTGGC at 63,178,643 bp (GRCm38/mm10). This mutation deletes exon 3 and 202 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 67 and early truncation 34 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Eef1b2 Mutation: 31 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)