Eef1b2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Eef1b2^em1(IMPC)J
• Name: eukaryotic translation elongation factor 1 beta 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5823412
• Synonyms: Eef1b2^em1J
• Gene: Eef1b2 Location: Chr1:63215990-63219645 bp, + strand Genetic Position: Chr1, 32.31 cM, cytoband C2
• Alliance: Eef1b2^em1(IMPC)J page
• IMPC: Eef1b2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences CAAGCATATTGAGAAGCCTG, GCCACGCCAGGATCCATCCA, TTAACCTTTAGCACAATCCC, and TTGTGTGTTTTGCCTAGAAA that targeted exon(s) ENSMUSE00001273257.2. This resulted in deletion(s) of 329 bp (location: Chr1:63217474-63217802; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Eef1b2 Mutation: 34 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)