About   Help   FAQ
Alg9em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Alg9em1(IMPC)J
Name: ALG9 alpha-1,2-mannosyltransferase; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5823410
Synonyms: Alg9em1J
Gene: Alg9  Location: Chr9:50686570-50754939 bp, + strand  Genetic Position: Chr9, 27.75 cM
Alliance: Alg9em1(IMPC)J page
IMPC: Alg9 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Alg9-8257J-M6224 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTATCAGGAAGGTCCTGCTA, TTAGTGTGTACCTTAGAAGC, TCGCCTAAATTTGAGCTGCT and TTGATCTTGATTTGGTACTT, which resulted in a 484 bp deletion beginning at Chromosome 9 negative strand position 50,776,825 bp, GTACCAAATCAAGATCAAAG, and ending after CGTCCACTTCCTGCTTCTAA at 50,776,342 bp (GRCm38/mm10). This mutation deletes exon 2 and 348 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 46 and early truncation 51 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Alg9 Mutation:  36 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory