About   Help   FAQ
4930447C04Rikem1Amp
Endonuclease-mediated Allele Detail
Summary
Symbol: 4930447C04Rikem1Amp
Name: RIKEN cDNA 4930447C04 gene; endonuclease-mediated mutation 1, Alberto M Pendas
MGI ID: MGI:5823358
Synonyms: Six6os1-
Gene: 4930447C04Rik  Location: Chr12:72926967-72964742 bp, - strand  Genetic Position: Chr12, 30.3 cM, cytoband C3
Alliance: 4930447C04Rikem1Amp page
Mutation
origin
Strain of Origin:  (C57BL/6J x CBA/J)F1
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsA 124bp deletion (GRCm39:chr12:72963494-72963618) that includes part of exon 2, intron 2 and part of exon 3 was created by CRISPR/Cas9 genome editing using sgRNAs (targeting CACCGATCTGTTTGTCAGTTTGGAC, AAACGTCCAAACTGACAAACAGATC, CACCGTACTTATGTCTTGCTCATAC and AAACGTATGACAAGACATAAGTAC). Spermatocytes from homozygous mice showed no protein expression by immunofluorescence studies, suggesting that this is a null allele. (J:238491)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 6 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any 4930447C04Rik Mutation:  29 strains or lines available
References
Original:  J:238491 Gomez-H L, et al., C14ORF39/SIX6OS1 is a constituent of the synaptonemal complex and is essential for mouse fertility. Nat Commun. 2016 Oct 31;7:13298
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory