Brip1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Brip1em1(IMPC)J |
| Name: |
BRCA1 interacting protein C-terminal helicase 1; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5823287 |
| Synonyms: |
Brip1em1J |
| Gene: |
Brip1 Location: Chr11:85948964-86092019 bp, - strand Genetic Position: Chr11, 51.61 cM
|
| Alliance: |
Brip1em1(IMPC)J page
|
| IMPC: |
Brip1 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project Brip1-8371J-M2241 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCTCAGTAAAAACACACACG, TGATATTTCAGACTGCTAGT, CAGGAAACACAGTTACAGCG and CTTCTGTGCTGTTCTAGTCG, which resulted in a 407 bp deletion beginning at Chromosome 11 negative strand position 86,198,119 bp, CGCGCTGTAACTGTGTTTCC, and ending after CGTGTGTGTTTTTACTGAGC at 86,197,713 bp (GRCm38/mm10). This mutation deletes exon 3 and 295 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 31 and early truncation 7 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
5 reference(s) |
|