About   Help   FAQ
C7em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: C7em1(IMPC)J
Name: complement component 7; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5823284
Synonyms: C7em1J
Gene: C7  Location: Chr15:5018244-5093222 bp, - strand  Genetic Position: Chr15, 1.98 cM
Alliance: C7em1(IMPC)J page
IMPC: C7 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project C7-8272J-M2250 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AAACCAGAACAAAAACCGTG, TCTGAAAACACGGAAAGATA, GCACTTAAGTGTGGATTTGT and TAAATACTTGCACTTAAGTG, which resulted in a 247 bp deletion beginning at Chromosome 15 negative strand position 5,059,535 bp, AATCCACACTTAAGTGCAAG, and ending after TTAGATGTTTATGCACCTTAT at 5,059,289 bp (GRCm38/mm10). This mutation deletes exon 2 and 191 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 2 and early truncation 42 amino acids later. In addition there is a single bp deletion (G) in the intron 91 bases after the deletion that will not alter the results of the deletion. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any C7 Mutation:  55 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  9 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory