C7^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: C7^em1(IMPC)J
• Name: complement component 7; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5823284
• Synonyms: C7^em1J
• Gene: C7 Location: Chr15:5018244-5093222 bp, - strand Genetic Position: Chr15, 1.98 cM
• Alliance: C7^em1(IMPC)J page
• IMPC: C7 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project C7-8272J-M2250 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AAACCAGAACAAAAACCGTG, TCTGAAAACACGGAAAGATA, GCACTTAAGTGTGGATTTGT and TAAATACTTGCACTTAAGTG, which resulted in a 247 bp deletion beginning at Chromosome 15 negative strand position 5,059,535 bp, AATCCACACTTAAGTGCAAG, and ending after TTAGATGTTTATGCACCTTAT at 5,059,289 bp (GRCm38/mm10). This mutation deletes exon 2 and 191 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 2 and early truncation 42 amino acids later. In addition there is a single bp deletion (G) in the intron 91 bases after the deletion that will not alter the results of the deletion. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any C7 Mutation: 55 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 9 reference(s)