About   Help   FAQ
Nipsnap2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Nipsnap2em1(IMPC)J
Name: nipsnap homolog 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5819283
Synonyms: Nipsnap2em1J
Gene: Nipsnap2  Location: Chr5:129802127-129835391 bp, + strand  Genetic Position: Chr5, 68.26 cM
Alliance: Nipsnap2em1(IMPC)J page
IMPC: Nipsnap2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Gbas-8294J-M2404 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAGCGGCGCCGATTAAACAG, GACTGCCTCTACAACATACG, ATAACTCAAGGGCAGATACG and ATAACTCAAGGGCAGATACG, which resulted in a 365 bp deletion beginning at Chromosome 5 positive strand position 129,744,664 bp, GCTCCCCTGTTTAATCGGCG, and ending after AACTCAAGGGCAGATACGAG at 129,745,028 bp (GRCm38/mm10). This mutation deletes exon 4 and 270 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a four bp deletion (GTAT) 68 bp before the 365 bp del that will not alter the effect of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 88 and early truncation 5 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Nipsnap2 Mutation:  26 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory