Nipsnap2em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Nipsnap2em1(IMPC)J |
| Name: |
nipsnap homolog 2; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5819283 |
| Synonyms: |
Nipsnap2em1J |
| Gene: |
Nipsnap2 Location: Chr5:129802127-129835391 bp, + strand Genetic Position: Chr5, 68.26 cM
|
| Alliance: |
Nipsnap2em1(IMPC)J page
|
| IMPC: |
Nipsnap2 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project Gbas-8294J-M2404 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAGCGGCGCCGATTAAACAG, GACTGCCTCTACAACATACG, ATAACTCAAGGGCAGATACG and ATAACTCAAGGGCAGATACG, which resulted in a 365 bp deletion beginning at Chromosome 5 positive strand position 129,744,664 bp, GCTCCCCTGTTTAATCGGCG, and ending after AACTCAAGGGCAGATACGAG at 129,745,028 bp (GRCm38/mm10). This mutation deletes exon 4 and 270 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a four bp deletion (GTAT) 68 bp before the 365 bp del that will not alter the effect of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 88 and early truncation 5 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
2 reference(s) |
|