Nipsnap2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nipsnap2^em1(IMPC)J
• Name: nipsnap homolog 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5819283
• Synonyms: Nipsnap2^em1J
• Gene: Nipsnap2 Location: Chr5:129802127-129835391 bp, + strand Genetic Position: Chr5, 68.26 cM
• Alliance: Nipsnap2^em1(IMPC)J page
• IMPC: Nipsnap2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Gbas-8294J-M2404 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAGCGGCGCCGATTAAACAG, GACTGCCTCTACAACATACG, ATAACTCAAGGGCAGATACG and ATAACTCAAGGGCAGATACG, which resulted in a 365 bp deletion beginning at Chromosome 5 positive strand position 129,744,664 bp, GCTCCCCTGTTTAATCGGCG, and ending after AACTCAAGGGCAGATACGAG at 129,745,028 bp (GRCm38/mm10). This mutation deletes exon 4 and 270 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a four bp deletion (GTAT) 68 bp before the 365 bp del that will not alter the effect of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 88 and early truncation 5 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Nipsnap2 Mutation: 26 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)