Zfp7em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Zfp7em1(IMPC)J |
| Name: |
zinc finger protein 7; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5819276 |
| Synonyms: |
Zfp7em1J |
| Gene: |
Zfp7 Location: Chr15:76763459-76776595 bp, + strand Genetic Position: Chr15, 36.28 cM
|
| Alliance: |
Zfp7em1(IMPC)J page
|
| IMPC: |
Zfp7 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project Zfp7-8177J-F8938 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTAGCTGTGTCTGTTCAGTG, AGGTATGCGATCAGGCCCAG, CCGGTCTGACCGGTTCCCAG and CCAGGTCTGCTCCAAACCCC, which resulted in a 436 bp deletion beginning at Chromosome 15 positive strand position 76,880,855 bp GGCCTGATCGCATACCTAGC, and ending after CTCCAAACCCCGGGCACGTG at 76,881,288 bp (GRCm38/mm10). This mutation deletes exon 3 and 307 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 1 and early truncation 9 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|