About   Help   FAQ
Zfp7em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Zfp7em1(IMPC)J
Name: zinc finger protein 7; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5819276
Synonyms: Zfp7em1J
Gene: Zfp7  Location: Chr15:76763459-76776595 bp, + strand  Genetic Position: Chr15, 36.28 cM
Alliance: Zfp7em1(IMPC)J page
IMPC: Zfp7 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Zfp7-8177J-F8938 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTAGCTGTGTCTGTTCAGTG, AGGTATGCGATCAGGCCCAG, CCGGTCTGACCGGTTCCCAG and CCAGGTCTGCTCCAAACCCC, which resulted in a 436 bp deletion beginning at Chromosome 15 positive strand position 76,880,855 bp GGCCTGATCGCATACCTAGC, and ending after CTCCAAACCCCGGGCACGTG at 76,881,288 bp (GRCm38/mm10). This mutation deletes exon 3 and 307 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 1 and early truncation 9 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Zfp7 Mutation:  46 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory