About   Help   FAQ
Fdx2em1Murr
Endonuclease-mediated Allele Detail
Summary
Symbol: Fdx2em1Murr
Name: ferredoxin 2; endonuclease-mediated mutation 1, Stephen Murray
MGI ID: MGI:5819262
Synonyms: Fdx1lem1Murr
Gene: Fdx2  Location: Chr9:20978808-20984827 bp, - strand  Genetic Position: Chr9, 7.7 cM, cytoband A3
Alliance: Fdx2em1Murr page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and single guide sequence TCCGGTCACGTGGCCTATCA, which resulted in a 13 bp deletion (ATCATGGCCGCCT) beginning at Chromosome 9 negative strand position 21,073,509 bp, and ending after 21,073,497 bp (GRCm38/mm10). This mutation deletes the start of exon 1 and 3 bp of flanking intronic sequence including the splice acceptor and is predicted to be a null allele. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Fdx2 Mutation:  13 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory