Osbpl5em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Osbpl5em1(IMPC)J |
| Name: |
oxysterol binding protein-like 5; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5818708 |
| Synonyms: |
Osbpl5em1J |
| Gene: |
Osbpl5 Location: Chr7:143242499-143310722 bp, - strand Genetic Position: Chr7, 88.29 cM
|
| Alliance: |
Osbpl5em1(IMPC)J page
|
| IMPC: |
Osbpl5 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project Osbpl5-8180J-F0511 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCTCAAACTGCAGAGCCAGG, AGTGAGAGAGTCACACAAAT, GGTGGCCCCGAAGAGTGAGG and TCAGACCTCATCTAAGGCTA, which resulted in a 309 bp deletion beginning at Chromosome 7 negative strand position 143715937 bp, CTCACTCTTCGGGGCCACCT, and ending after GGATCTGGGGTCCTCCTGGC at 143,715,629 bp (GRCm38/mm10). This mutation deletes exon 2 and 152 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 17 and early truncation 75 amino acids later.
(J:188991, J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|