About   Help   FAQ
Osbpl5em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Osbpl5em1(IMPC)J
Name: oxysterol binding protein-like 5; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5818708
Synonyms: Osbpl5em1J
Gene: Osbpl5  Location: Chr7:143242499-143310722 bp, - strand  Genetic Position: Chr7, 88.29 cM
Alliance: Osbpl5em1(IMPC)J page
IMPC: Osbpl5 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Osbpl5-8180J-F0511 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCTCAAACTGCAGAGCCAGG, AGTGAGAGAGTCACACAAAT, GGTGGCCCCGAAGAGTGAGG and TCAGACCTCATCTAAGGCTA, which resulted in a 309 bp deletion beginning at Chromosome 7 negative strand position 143715937 bp, CTCACTCTTCGGGGCCACCT, and ending after GGATCTGGGGTCCTCCTGGC at 143,715,629 bp (GRCm38/mm10). This mutation deletes exon 2 and 152 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 17 and early truncation 75 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Osbpl5 Mutation:  52 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/13/2026
MGI 6.24
The Jackson Laboratory