About   Help   FAQ
Chd3em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Chd3em1(IMPC)J
Name: chromodomain helicase DNA binding protein 3; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5818701
Synonyms: Chd3em1J
Gene: Chd3  Location: Chr11:69234099-69260232 bp, - strand  Genetic Position: Chr11, 42.53 cM
Alliance: Chd3em1(IMPC)J page
IMPC: Chd3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Chd3-8127J-F9396 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTACCAGGCTAGAGAAAGTG, TTCTTTCTCTCAGATGGCGA, TGACCTCCATTCAGAACCAG and GTTCCTAGAGAGTGCCACGG, which resulted in a 343 bp deletion beginning at Chromosome 11 negative strand position 69,364,877 bp, ACGGTGGCAGTAAGAAGGGG, and ending after ACTTGGAACCCTAACCCCAC at 69,364,535 bp (GRCm38/mm10). This mutation deletes exon 2 and 230 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 85 and early truncation 2 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Chd3 Mutation:  101 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/23/2024
MGI 6.23
The Jackson Laboratory