About   Help   FAQ
Bpiem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Bpiem1(IMPC)J
Name: bactericidal permeablility increasing protein; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5817807
Synonyms: Bpiem1J
Gene: Bpi  Location: Chr2:158100014-158126451 bp, + strand  Genetic Position: Chr2, 78.72 cM
Alliance: Bpiem1(IMPC)J page
IMPC: Bpi gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Bpi-8189J-M1381 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTATCTCTGTGACATCGGAG, CCTGGCTGTCTGAAGATGCA, TAGGCTGCTTAGGTTCACCG and TTGATGATCACCCTACAAGG, which resulted in a 284 bp deletion beginning at Chromosome 2 positive strand position 158,260,936 bp, GTCTGAAGATGCAGGGGCTG, followed by 16 retained endogenous bases (GTGGAAACTGCCCGT), followed by a second deletion of 96 bp that ends after TGAGACTTTTTCCTCTGCAG at 158,261,331 bp (GRCm38/mm10). This mutation deletes exon 2 and 281 bp of flanking intronic sequence, including the splice acceptor and donor for exon 2 and the splice acceptor for exon 3. This allele has an additional 11 bp deletion (CATCGGAGTGG) 49 bp before the 284 bp deletion that will not effect the result of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 44 and early truncation 8 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Bpi Mutation:  27 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/21/2024
MGI 6.23
The Jackson Laboratory