About   Help   FAQ
Cgref1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Cgref1em1(IMPC)J
Name: cell growth regulator with EF hand domain 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5817761
Synonyms: Cgref1em1J
Gene: Cgref1  Location: Chr5:31090487-31102771 bp, - strand  Genetic Position: Chr5, 16.9 cM
Alliance: Cgref1em1(IMPC)J page
IMPC: Cgref1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Cgref1-8199J-F4208 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCCCAGTGTGAAGCATCAGA, TTAGAATAAGACCTGACACT, GGAGGACTATGAATACCCAT and GAATGGTTCCACATGCAAGG, which resulted in a 489 bp deletion beginning at Chromosome 5 negative strand position 30,936,119 bp, GTATTCATAGTCCTCCCTGA, and ending after AGAATAAGACCTGACACTGG at 30,935,631 bp (GRCm38/mm10). This mutation deletes exon 2 and 386 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 39 and early truncation 31 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 1 RNA-Seq or microarray experiment(s)
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Cgref1 Mutation:  15 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory