About   Help   FAQ
Mccc2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Mccc2em1(IMPC)J
Name: methylcrotonoyl-Coenzyme A carboxylase 2 (beta); endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5817349
Synonyms: Mccc2em1J
Gene: Mccc2  Location: Chr13:100085040-100152147 bp, - strand  Genetic Position: Chr13, 52.9 cM
Alliance: Mccc2em1(IMPC)J page
IMPC: Mccc2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Mccc2-8043J-M4937 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGGGTACAGAAGACACGCTG, ATTTAGAAGCATTTGTTGAT, GTAAAGTGCCGTGTTTGGCG and ACAATGCTCCACGCCAAACA, which resulted in a 511 bp deletion beginning at Chromosome 13 positive strand position 99,993,340 bp, CATGCTGGATGCTGCCATGC, and ending after GCAGATCTCTCAGTTTGGAG at 99,993,850 bp (GRCm38/mm10). This mutation deletes exon 3 and 426 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 66 and early truncation 34 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Mccc2 Mutation:  24 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/07/2025
MGI 6.24
The Jackson Laboratory