Mccc2em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Mccc2em1(IMPC)J |
| Name: |
methylcrotonoyl-Coenzyme A carboxylase 2 (beta); endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5817349 |
| Synonyms: |
Mccc2em1J |
| Gene: |
Mccc2 Location: Chr13:100085040-100152147 bp, - strand Genetic Position: Chr13, 52.9 cM
|
| Alliance: |
Mccc2em1(IMPC)J page
|
| IMPC: |
Mccc2 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project Mccc2-8043J-M4937 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGGGTACAGAAGACACGCTG, ATTTAGAAGCATTTGTTGAT, GTAAAGTGCCGTGTTTGGCG and ACAATGCTCCACGCCAAACA, which resulted in a 511 bp deletion beginning at Chromosome 13 positive strand position 99,993,340 bp, CATGCTGGATGCTGCCATGC, and ending after GCAGATCTCTCAGTTTGGAG at 99,993,850 bp (GRCm38/mm10). This mutation deletes exon 3 and 426 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 66 and early truncation 34 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|