About   Help   FAQ
Gnb2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Gnb2em1(IMPC)J
Name: guanine nucleotide binding protein (G protein), beta 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5817218
Synonyms: Gnb2em1J
Gene: Gnb2  Location: Chr5:137526389-137531772 bp, - strand  Genetic Position: Chr5, 76.54 cM
Alliance: Gnb2em1(IMPC)J page
IMPC: Gnb2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Gnb2-8128J-M9422 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCCCATTCTTCAGTGCCCCA, ATGGGCAGAATGATAGTACA, TCCCATTCTTCAGTGCCCCA and ATGATGGGCAGTGCAAGAGA, which resulted in a 359 bp deletion beginning at Chromosome 5 negative strand position 137,530,468 bp, TTTCCCTCTCTTGCACTGCC, and ending after ATGGGCAGAATGATAGTACA at 137,530,110 bp (GRCm38/mm10). This mutation deletes all of exons 3 and 4 and 106 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 2bp (AA) deletion 90 bp before the large deletion that will not effect the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 19 and early truncation 19 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Gnb2 Mutation:  23 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory