About   Help   FAQ
Sdr42e1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Sdr42e1em1(IMPC)J
Name: short chain dehydrogenase/reductase family 42E, member 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5817201
Synonyms: Sdr42e1em1J
Gene: Sdr42e1  Location: Chr8:118388138-118400428 bp, - strand  Genetic Position: Chr8, 64.69 cM
Alliance: Sdr42e1em1(IMPC)J page
IMPC: Sdr42e1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Sdr42e1-7839J-F8886 was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences TAGGCCACTGGTCGAGGGCC and GTCGCCTCTTACGGCATGTC, which resulted in a 604 bp deletion beginning at Chromosome 8 negative strand position 117,663,658 bp CTCTTACGGCATGTCTGGGA and ending after ACACATTCCCATCCACCCGC at 117,663,055 bp (GRCm38/mm10). This mutation deletes 604 bp of exon 3 and is predicted to cause a change of amino acid sequence after residue 81 and early truncation 2 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Sdr42e1 Mutation:  19 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory