Rab5b^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rab5b^em1(IMPC)J
• Name: RAB5B, member RAS oncogene family; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5817196
• Synonyms: Rab5b^em1J
• Gene: Rab5b Location: Chr10:128513044-128532133 bp, - strand Genetic Position: Chr10, 77.13 cM
• Alliance: Rab5b^em1(IMPC)J page
• IMPC: Rab5b gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Rab5b-8208J-M5447 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCTTCCAAGCACTAAGCCGG, AGCTTCATAGATATTAAGTT, ACCAAGGCCCACCAGCTACA and GTTGTAAGTGGGACAAAGGG, which resulted in a 380 bp deletion beginning at Chromosome 10 negative strand position 128,683,459bp GCTGGTGGGCCTTGGTGGCA, and ending after TATGCTTCCAAGCACTAAGC at 128,683,080 bp (GRCm38/mm10). This mutation deletes exon 3 and 228 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 54 and early truncation 19 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Rab5b Mutation: 33 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)