Agfg2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Agfg2^em1(IMPC)J
• Name: ArfGAP with FG repeats 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5816161
• Synonyms: Agfg2^em1J
• Gene: Agfg2 Location: Chr5:137648725-137682988 bp, - strand Genetic Position: Chr5, 76.59 cM
• Alliance: Agfg2^em1(IMPC)J page
• IMPC: Agfg2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences CACAGAAGATGGTCTCAGTC, CTCAAAGCTTTGCTACCAAG, GCTGTGGCAGGTGAGTGCAC, and TCCCAAAAGAAACTTTTGGG that targeted exon(s) ENSMUSE00001287106.2. This resulted in deletion(s) of 3 bp (location: Chr5:137665733-137665735; GRCm39), 5 bp (location: Chr5:137665700-137665704; GRCm39), and 562 bp (location: Chr5:137665883-137666444; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Agfg2 Mutation: 23 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)